Morphological and Molecular
Characterization of Large-spored Alternaria Species Associated with
Potato and Tomato Early Blight in Egypt
1Department of
Arid Land Agriculture, College of Agriculture and Food Sciences, King Faisal
University, Al-Ahsa, 31982, Saudi Arabia
2Vegetable
Diseases Research Dept., Plant Pathology Research Institute, ARC, Giza, Egypt
3Mycology
Research & Disease Survey, Plant Pathology Research Institute, ARC, Giza,
Egypt
4Central
Laboratories, King Faisal University, Al-Ahsa, 31982,
Saudi Arabia
*For correspondence: salganainy@kfu.edu.sa;
sherifmsc2000@yahoo.com
Received
08 January 2021; Accepted 09 February 2021; Published 16 April 2021
Abstract
Early blight incurs huge losses to solanaceous crops at
both pre- and post-harvest stages by reducing yields up to 35–78%. Large-spored Alternaria
spp. were isolated and characterized from the symptomatic tomato and potato
plants. Morphological characterization revealed heterogeneity in the different
traits of the isolates, which were subsequently confirmed by molecular
characterization and two different Alternaria spp. viz. A. solani and A.
linariae were characterized. A multi-locus
phylogenetic analysis was conducted to infer the taxonomic position of the
isolates within Alternaria spp. The five conserved genome regions used
to infer phylogenetic lineage and evolutionary relationship were the internal
transcribed spacer (ITS), the translation elongation factor (TEF), the
glyceraldehyde-3-phosphate dehydrogenase (GADPH), the major allergen Alt
a1 (Alt a1) and the RNA-polymerase 2 (RPB2) genes. All A. linariae isolates were closely related and formed a
clade to A. linariae isolated from the
United States. Similarly, A. solani
isolates were closely related to each other and formed an independent clade
indicating their unique nature. Koch’s postulates were fulfilled for all the
isolates. Among six different tested fungicides, aveet
(azoxystrobin 5% + mancozeb 70%) inhibited the mycelial growth the most and
saver (cymoxanil 5% + chlorothalonil 37%) the least. All the isolates infected
tomato and potato leaves with varying severity except A. linariae isolate
Egy-T2 was non-pathogenic on potato leaves, while the
rest of A. linariae isolates were more
aggressive. Here, we demonstrated that early blight in Egypt is caused by two
different species of fungal pathogens, A. linariae
and A. solani, and reported isolation of A.
linariae from Egypt. © 2021 Friends Science
Publishers
Keywords: Alternaria linariae; Alternaria solani; Early
blight; Multi-locus phylogeny; Potato; Tomato
Introduction
Potato (Solanum tuberosum L.) and tomato (Solanum
lycopersicum L.) are the most important vegetable
cash crops in the world. Potato is the world’s third most-produced crop with an
annual production of 368.17 million metric tons (MMT) (FAOSTAT 2018) and is
grown on all continents except Antarctica (Birch et al. 2012).
Tomato is the world’s largest produced vegetable crop with 182.26 MMT annual
production (FAOSTAT 2018) and its cultivation area has increased by 164% in the
last 40 years with an increase of 314% in its consumption (Nicola et
al. 2009). Potato is Egypt’s second most cultivated crop with an
annual production of about 5 million tons (FOASTAT 2018), while tomato is
Egypt’s top-ranked horticulture crop in terms of production and the area under
cultivation (ca 161702 hectares) (FAOSTAT 2018). Globally, Egypt is the 5th
largest producer of tomatoes in the world with an annual production of 6.62 MMT
(Siam
and Abdelhakim 2018; Abdel-Motaal et al. 2020a).
Both potatoes and tomatoes are Egypt’s important sources of food, feed,
livelihood and foreign exchange, with annual exports (both fresh and processed)
amounting to 90,000 million tonns and 674,480 tons,
respectively (Siam and Abdelhakim 2018).
Nonetheless, the production of tomatoes and potatoes in Egypt is threatened by
several biotic stresses, among which early blight disease is a leading threat
to potatoes and tomatoes production. The disease is responsible for
considerable yield losses worldwide and accounts for up to a 78% reduction in yields (Gannibal et al. 2014; Adhikari et al. 2017). Early
blight disease can infer losses of up to 20% to potatoes production and 78% to
tomatoes production (Rotem 1994; Gannibal et al. 2014).
Early blight induces characteristics symptoms of dark-colored
spots, which are necrotic in the middle with a unique pattern of concentric
rings, ridges and lesions on the leaves but can also spread to stem, twigs and
fruits (Grigolli et al. 2011). The onset
of symptoms initially appears on the basal and mature leaves as small,
irregular or circular brown zonate lesions. These symptoms progress gradually
to the upper leaves and then turn into dark colored spots with a characteristic “target-spot
appearance” (Weber and Halterman 2012; Zheng et
al. 2015). Severe infection can lead to twig drying, defoliation and
premature fruit falling under favourable conditions (Khan et al. 2018) and the severity of infection usually
turns into an epidemic in semi-arid areas with frequent and prolonged night dew
(Rotem and Reichert 1964).
Alternaria solani was initially considered the sole species inducing
early blight disease in solanaceous crops (Chaerani
and Voorrips 2006; Gannibal et al. 2014). However, a range of
physiological characteristics such as pathogenicity, cultural characteristics,
phenetic and genetic polymorphisms observed within A. solani populations (Weber
and Halterman 2012) led to the taxonomic revision of Alternaria
species from Solanaceous hosts (Simmons 2000). Consequently, several new
species related to early blight disease of potatoes and tomatoes were described
(Simmons 2000, 2007). In addition,
small-spored Alternaria spp. associated with foliar disease of potatoes
and tomatoes were demonstrated as A. alternata,
A. arborescens and A. tenuissima (Simmons
2000). Nonetheless, besides sharing striking similarities, A. solani isolated from tomato was referred to as A.
tomatophila (Simmons 2000). Recently, isolates
belonging to this species have been recategorized to a new species and referred
to as A. linariae (Woudenberg et al. 2014).
Most of the studies demonstrating
fungal characterization relied on morphological identification coupled to the
molecular characterization. Using morphological identification along with
multi-locus phylogenetic analysis is considered as a robust approach for fungal
characterization. Several studies encompassing the molecular characterization
of Alternaria species have demonstrated different genetic loci to infer
the genetic and evolutionary relationship (Lawrence
et al. 2013; Woudenberg et al. 2013; Javaid et al. 2016). The most widely used genetic loci include ITS,
SSU rDNA, TEF, GADPH, RPB2 and Alt a1 (Woudenberg et al. 2014, et al. 2015;
Javaid et al. 2018).
The most common measure to
control early blight disease is the application of fungicides. The most
commonly used fungicides belong to the Quinone inhibitor group. Different
fungicides such as azoxystrobin, mancozeb, difenoconazole, chlorothalonil and
carbendazim have been reported to curb early blight disease (Rosenzweig et al. 2008; Horsfield et al.
2010; Odilbekov et al. 2019). However, these fungicides have a
very specific mode of action that can lead to the development of fungicide
resistance (Leiminger et al. 2014; Odilbekov
et al. 2019), and therefore, it is recommended that alternative
fungicides be used or combined with other fungicides having different modes of
action.
Several Alternaria spp.
have been found infecting potatoes and tomatoes in Egypt and the growing
diversity of the Alternaria spp. has changed the paradigm. The study
demonstrated here was therefore aimed at deciphering the EB pathogen associated
with potato and tomato plants by their morphological and molecular
characterization. Our results, to our best knowledge and literature surveyed,
demonstrated the isolation of A. linariae
from tomato plants that have not yet been reported earlier in Egypt. However, a
complete survey and an epidemiological study is a prerequisite to evaluate the
threat associated with A. linariae to
tomatoes and potatoes production in Egypt.
Materials and Methods
Sampling and isolation of Alternaria species
Tomato leaves, fruits and potato tubers exhibiting early
blight symptoms, like dark-colored necrotic spots
with a unique pattern of concentric rings, were surveyed. A total of 140
symptomatic samples, 20 from each location, were collected during the 2018–2019
crop seasons from major crop growing areas viz.,
Aswan, Beheira, Beni-suef,
Giza, Kafr El-Sheik, Qena and Sharqia
of Egypt (Table 1). The collected samples were sliced into small pieces
(approx.5×5 mm) around the lesion and then surface sterilized for 2 min (min)
in sodium hypochlorite (2%) followed by excessive rinsing (2–3 times) with
sterile distilled water (SDW). The cuttings were shifted onto Potato Dextrose
Agar (PDA; Difco, Montreal, Canada) media
supplemented with 100 mg L-1 streptomycin sulphate and incubated at
25 ± 1°C for 7 days. Growing colonies were observed on the isolated cuttings
and, subsequently, colonies were sub-cultured onto PDA plates to yield purified
culture. Pure culture of each grown isolate was obtained using the hyphal tip
method and maintained at 4°C on PDA slants for subsequent study.
Morphological characterization of the large-spored Alternaria
species
Purified
fungal isolates were identified based on their morphological characters,
including spore size, growth pattern and spore chain formation (Simmons 2007). Colony morphology (color and colony texture) was assessed on corn meal agar
(CMA), malt extract agar (MEA), PDA and V8 juice agar (V8JA) media at 25°C for
10 days. To examine the spores, purified fungal isolates were grown on V8JA
plates at 25°C for 7 days with 16 h of photoperiod. Aerial mycelia were removed
and the colony surface was gently wounded to allow mycelia to produce spores
and after 48 h, spores were examined (Langsdorf et al. 1990). A total of 50
fungal conidia were observed under a light microscope (Leica, CME Microscope
Model 1349522X, U.S.A.) using differential interference contrast illumination,
photographs were recorded and edited in the Adobe Illustrator (v. 23.0.5,
2019).
DNA extraction, PCR amplification and sequencing
Total genomic DNA extraction from seven fungal isolates
was performed after following an amended Dellaporta
extraction method (Dellaporta et
al. 1983). About 100 mg (fresh weight) of fungal mycelia were
harvested by scraping the surface of the colony to
extract the DNA. The quality and quantity of the extracted DNAs were
assessed spectrophotometrically (NanoDrop 2000,
Thermo Fisher Scientific, DE, U.S.A.) and adjusted to a concentration of 40 ng μL-1
in ultrapure water. The extracted DNA was aliquoted and stored at –80°C until
further use.
Five partial regions of the
isolated fungal genome, the internal transcribed spacer region (ITS) was
amplified with ITS4 and ITS5 primers, the translation elongation factor
1-α gene (Tef1) with EF1-688F and EF1-1251R primers, the
glyceraldehyde 3-phosphate (GADPH) with Gpd_F
and Gpd_R primers, RNA-polymerase 2 (RPB2)
with RPB2-6F/RPB2-7cR primers and the Alta1 region (Alta 1) with
Alt-al-for and Alt-al-rev primers (Table 2). PCR amplification was achieved
separately for each genomic region in a 25 µL reaction containing 1 µL
of the fungal DNA extract (40 ng μL-1 of total DNA), 2.5
of 10 X PCR buffer (Biomatic, Life Technologies, U.S.A.),
2 mM MgCl2, 1.5 µL of 10 µM of each primer, 2.5
µL of 10 mM dNTPs, 0.3 µL of 5U Taq DNA Polymerase and the
reaction was completed to 25 mL with
Nuclease-free water. All the PCR amplicons were completely sequenced (Macrogen Inc., South Korea).
Phylogenetic analysis
To infer the phylogenetic lineage and evolutionary
relationship of the isolates, all the five genes (ITS, TEF, GAPDH,
Alta1 and RPB2) were initially BLASTn
searched (http://blast.ncbi.nlm.nih.gov/Blast.cgi) and Alternaria spp.
showing the highest sequence similarity to the five genes were retrieved from
GenBank for subsequent analysis (Table 1). Multiple sequence alignment was
conducted using MUSCLE (Edgar 2004) and
the evolutionary relationship was inferred by using the maximum likelihood (ML)
algorithm after selecting the best fit Tamura-Nei
(TN93+G+I) model (Tamura and Nei 1993) in
MEGA X (Kumar et al. 2018). The
phylogenetic dendrogram (1000 replicates of bootstrap) was constructed with an
optimal tree having the highest log-likelihood -6928.26.
Pathogenicity test on detached leaves
Pathogenicity of the seven isolates of large-spored Alternaria
spp. was evaluated under in vitro conditions by inoculating the detached
leaflets of 30-days-old tomato (cv. Super Strain B) and potato (cv. Spunta) plants. Fully expanded disease-free young leaflets
of tomato and potato plants grown under greenhouse conditions were used after
surface sterilization with sodium hypochlorite (2%) and then washing with SDW.
The spore suspension was prepared by pouring 10 mL of SDW into the sporulated
isolates growing on V8JA plates, and the spores count was adjusted to 1 x 106
conidia/mL using a haemocytometer, then 20 µL droplet was inoculated on
the adaxial sides of the leaflets, while 20 µL SDW droplet was used as a
negative control. Each inoculation was replicated seven times and the whole
experiment was repeated twice. Inoculated leaflets were placed on sterilized
Petri dishes harboring wet sterilized tissue papers
and incubated at 25°C and 80% relative humidity with 12 h of photoperiod in the
growth chamber. The inoculated leaflets were observed on daily basis and the
symptoms on the leaves were recorded after seven days. Eventually, the
re-isolation of Alternaria spp. from the inoculated leaves was carried
out on PDA media to confirm the Koch’s postulate (Sharma et al. 2004).
A 0-5-point disease severity scale was followed (Vakalounakis
1983) and the disease severity index (DSI) was calculated as “DSI% = [100
× sum of all rating scales]/(N × maximum disease
scale), where n is the number of the infected leaflets and N is the total
number of leaves.
Evaluation of selected fungicides on the isolated Alternaria
spp.
The
poisoned food technique (Nene and Thapliyal 1993)
was used to assess the efficacy of six different commercially available
fungicides against the isolated Alternaria spp. (Table 3).
Recommended/standard quantity of each fungicide was added aseptically to the
molten PDA agar (50°C) and control plates were devoid of any fungicide. The
plates were inoculated aseptically with ten-day-old 5 mm mycelial disc and
incubated at 25 ± 2°C until the mycelial growth of the tested isolate covered
the entire media in the control plates. Four replicates of each inoculation
were used and the experiment was repeated twice. The diameter of the colonial
radial growth was recorded for each treatment, a mean of four replicates was
calculated, compared to the control and percent inhibition of mycelial growth
was determined using the formula given by (Vincent
1947):
I %=[( C-T)/C]
100
Where; I = Inhibition (%),
C = the mean of colony growth (mm) of the tested
isolate in untreated control plates
T = the mean of colony growth (mm) of the tested
isolate in treated plates
Data analysis
To evaluate the pathogenicity of the fungal isolates and
the effect of different fungicides, a completely randomized design was
employed. ANOVA and least significant difference (LSD) tests were conducted to
determine the statistical significance at P < 0.05. The collected
data were statistically analyzed using the MSTAT-C
program (v 2.10).
Table 1: Details of the Alternaria spp. isolates
from Egypt with reference isolates and their accession numbers used in the
study
Fungus |
Isolate Code |
Host, plant organ |
Origin |
Collection date |
GenBank accession No. |
||||
ITS |
Tef-1 |
GAPDH |
Alt a 1 |
RPB2 |
|||||
A. linariae |
Egy-T1 |
Solanum lycopersicum,
fruit |
Giza- Egypt |
2018 |
MT996270 |
MT996277 |
MT996256 |
MT996249 |
MT996263 |
A. linariae |
Egy-T2 |
S. lycopersicum, leaf |
Kafr el-sheikh |
2018 |
MT996271 |
MT996278 |
MT996257 |
MT996250 |
MT996264 |
A. linariae |
Egy-T3 |
S. lycopersicum, leaf |
Aswan- Egypt |
2018 |
MT996272 |
MT996279 |
MT996258 |
MT996251 |
MT996265 |
A. solani |
Egy-T4 |
S. lycopersicum, leaf |
Qena- Egypt |
2018 |
MT996273 |
MT996280 |
MT996259 |
MT996252 |
MT996266 |
A. linariae |
Egy-T5 |
S. lycopersicum, leaf |
Sharqia- Egypt |
2019 |
MT996274 |
MT996281 |
MT996260 |
MT996253 |
MT996267 |
A. linariae |
Egy-T6 |
S. lycopersicum, leaf |
Beheira- Egypt |
2019 |
MT996275 |
MT996282 |
MT996261 |
MT996254 |
MT996268 |
A. solani |
Egy-P1 |
Solanum tuberosum, tuber |
Giza- Egypt |
2019 |
MT996276 |
MT996283 |
MT996262 |
MT996255 |
MT996269 |
A. allii |
CBS
107.28 |
Allium cepa, leaf spot |
Puerto Rico |
- |
KJ718100 |
KJ718449 |
KJ717954 |
KJ718620 |
KJ718274 |
A. allii |
CBS 225.76 |
Allium porrum, leaf |
Italy |
- |
KJ718102 |
KJ718451 |
KJ717956 |
KJ718622 |
KJ718276 |
A. grandis |
CBS 109158 |
S. tuberosum, leaf |
U.S.A., Pennsylvania |
- |
KJ718239 |
EU130547 |
JQ646341 |
JQ646425 |
KJ718414 |
A. grandis |
CBS 116695 |
S. tuberosum, leaf |
U.S.A., Pennsylvania |
- |
KJ718241 |
KJ718587 |
KJ718070 |
KJ718748 |
KJ718416 |
A. limicola |
CBS 483.90 |
Citrus aurantiifolia, leaf |
Mexico, Colima |
- |
KJ718178 |
KJ718526 |
JQ646329 |
JQ646413 |
KJ718351 |
A. limicola |
CBS 117360 |
Citrus spp. |
Mexico, Jalisco |
- |
KJ718179 |
KJ718527 |
KJ718023 |
- |
KJ718352 |
A. linariae |
CBS 109156 |
Solanum lycopersicum,
leaf |
U.S.A., Indiana |
- |
KJ718183 |
KJ718531 |
JQ646347 |
JQ646431 |
KJ718356 |
A. multirostrata |
CBS 712.68 |
Richardia scabra, floral bract |
U.S.A., Georgia |
- |
KJ718195 |
EU130546 |
JQ646362 |
KJ718704 |
KJ718368 |
A. multirostrata |
CBS 713.68 |
Richardia scabra, floral bract |
U.S.A., Georgia |
- |
KJ718196 |
KJ718542 |
KJ718034 |
KJ718705 |
KJ718369 |
A. passiflorae |
CBS 113.38 |
Passiflora edulis |
Australia, South Queensland |
- |
KJ718207 |
KJ718553 |
JQ646353 |
JQ646437 |
KJ718380 |
A. passiflorae |
CBS 166.77 |
Capsicum frutescens, leaf |
New Zealand |
- |
KJ718208 |
KJ718554 |
KJ718044 |
KJ718716 |
KJ718381 |
A. solani |
CBS 111.41 |
Solanum aviculare, leaf |
|
- |
KJ718237 |
KJ718583 |
KJ718067 |
KJ718744 |
KJ718411 |
A. solani |
CBS 116442 |
Vicia faba |
New Zealand |
- |
KJ718240 |
KJ718586 |
KJ718069 |
KJ718747 |
KJ718415 |
A. solani |
CBS 109157 |
Solanum tuberosum |
U.S.A. |
- |
KJ718238 |
KJ718585 |
GQ180080 |
KJ718746 |
KJ718413 |
A. brassicicola |
CBS 118699 |
Brassica oleracea |
U.S.A. |
- |
KC584259 |
KC584642 |
KC584103 |
|
KC584383 |
Table 2: Nucleotide sequence of the primers used in the study
Locus Name |
Primer* |
Sequence (5’-3’) |
Reference |
ITS region |
ITS4 |
TCCTCCGCTTATTGATATGC |
White et al. (1990) |
ITS5 |
GGAAGTAAAAGTCGTAACAAGG |
||
Tef-1 |
EF1-688F |
CGGTCACTTGATCTACAAGTGC |
Alves et al. (2008) |
EF1-1251R |
CCTCGAACTCACCAGTACCG |
||
GADPH |
Gpd_F |
CAACGGCTTCGGTCGCATTG |
Berbee et al. (1999) |
Gpd_R |
GCCAAGCAGTTGGTTGTGC |
||
Alt
a 1 |
Alt-al-for |
ATG CAG TTC ACC ACC ATC GC |
Hong et al. (2005) |
Alt-a1-rev |
ACG AGG GTG AYG TAG GCG TC |
||
RPB2 |
RPB2-6F |
TGG GGK WTG GTY TGY CCT GC |
Liu et al. (1999). |
FRPB2-7cR |
CCC ATR GCT TGY TTR CCC AT |
*F for the forward primer and R for the
reverse primer
Table 3:
Details of the used fungicides, their active
ingredients and standard concentrations in
in vitro
evaluation
Fungicides No. |
Trade name |
Active ingredient |
Conc. * |
A |
Aveet 75% WG |
Azoxystrobin5% +
mancozeb 70% |
1 g L-1 |
D |
Decent plus 32% SC |
Difenoconazole
12.5% + Azoxystrobin 20% |
0.4 mL L-1 |
C |
Cuprofix CM |
Cymoxanil 2.5% + Metalic copper 15% |
1.5 g L-1 |
R |
Ridomil Gold R 26.89%WG |
Metalaxyl M2% + Metalic copper 14.19% |
3.3 g L-1 |
P |
Prevex-N72% SL |
Propamocarb
hydrochloride |
3 mL L-1 |
S |
Saver 42% SC |
Cymoxanil 5% + Chlorothalonil
37% |
3 mL L-1 |
* recommended dose
Results
Isolation and identification of Alternaria spp.
Microscopic examination of 63
purified isolates of Alternaria spp. revealed that 56 isolates were small
spored with abundant sporulation on the PDA media and were morphologically
assigned to A. alternata and A. tenuissima while 7 Alternaria isolates failed to
produce spores on the PDA media. All the small-spored Alternaria
isolates were excluded in this study, whereas different media including V8JA,
CMA and MEA were used to yield spores from the remaining 7 Alternaria
spp. Among the tested media, V8JA increased the mycelial growth followed by
MEA, PDA and CMA, respectively, and sporulation was observed only on V8JA two
days post mycelium removal. Whereas PDA and MEA media were best suited to
induce colony pigmentation. Detailed microscopic examination of morphological
characters on V8JA like sporulation patterns, conidia size and shape, and beak
length revealed the presence of two groups of large-spored Alternaria
spp. The identification of the purified isolates was achieved after following
the set-criteria for the sporulation of the Alternaria genus. The spores
of Alternaria isolates in this study exhibited a high-level of
resemblance to the large-spored Alternaria spp. associated with tomato
and potato groups and accepted as A. solani
and A. linariae. The isolates produced
olive green and brown conidia with conidium ellipsus
body shape and different numbers of cells per conidium (Table 4). Conidia were
generally individual, rarely in short chains, straight or slightly curved, or
with conidium ellipsus body tapering to an average
beak length 27.91–135.01 μm.
Conidia of A. linariae produced beak
length ranged from 64.09 to 135.01 μm, while body length ranged from 33.64 to 136.22 μm with a
width of 17.20 to 28.51 μm
(Fig. 1 and Table 4). While two isolates of A. solani
beak length ranged from 27.91 to 116.06 μm, with a conidium, the total length of 70.63 to 77.61
μm and
width of 16.94–25.05 μm
(Table 4). Colonies were thick grey to black with scattered aerial mycelium,
often branched and simple conidiophores with multi-septate conidia
Fig. 1: Colonies, sporulation patterns and conidia of four Alternaria
spp. isolates. Colonies of Egy-P1 (A), Egy-T1 (B), Egy-T3 (C), and Egy-T4 (D) observed on V8J agar plates; their sporulation patterns (E-H), and their conidia (I-L)
Fig. 2: Phylogenetic
tree illustrating the relationship between A. solani
and A. linariae isolates (highlighted
with a green circle) and other Alternaria spp. The phylogenetic tree is
based on the nucleotide sequences of five genes (ITS, TEF, GAPDH,
ALT and RPB2) and was produced in MEGAX using the maximum-likelihood
method and the best-fit model TN93+G+I. Only bootstrap values greater than 50%
are shown
constitute 0–7 transverse septa and 2–10 longitudinal
septa.
Molecular characterization of the large-spored Alternaria
spp.
To characterize two different types of conidia, all
isolates were subjected to molecular characterization by DNA-sequencing. PCR
amplicons of highly-variable to moderately variable genes, ITS (~550 bp), Tef-1
(~220 bp), GADPH (~580 bp), Alt a1 (~450 bp) and RPB2
(~760 bp) were achieved from all isolates and then completely sequenced. All
sequences were submitted to NCBI GenBank database (accession numbers mentioned
in Table 1) and BLASTn searched for the most closely
related sequences. To infer the phylogenetic lineage and evolutionary
relationship of the isolates, a multi-locus phylogeny was performed and
sequences of only those Alternaria strains, whose all five genes sequences were available at GenBank, were included in
the analysis, while A. brassicola (CBS
118699) was used as an outlier to validate the tree (Fig. 2). Neighbor-joining (NJ) and maximum likelihood (ML)
algorithms produced similar tree topologies but ML produced clades with higher
bootstrap values, therefore ML tree is shown. The isolates namely A. solani (Egy-P1 and Egy-T4) were closely related and
grouped with A. solani CBS 116442 (an
isolate from Netherland). The other isolates namely A. linariae (Egy-T1, Egy-T2, Egy-T3, Egy-T5 and Egy-T6)
formed a multiphyletic group together and were closely related to
other isolates of A. linariae (CBS
109156 [isolated from the United States] and CBS 105.41[isolated from
Netherland]). Within the A. linariae
group, a clear split was observed that formed 3 subgroups
with moderate-to-high bootstrap values (Fig. 2).
Pathogenicity tests on detached leaves
All the tested isolates of A. linariae
and A. solani produced early blight
symptoms on tomato and potato detached leaves irrespective of their host plant
origin. While control leaflets, inoculated with sterile distilled water
remained asymptomatic (Fig. 3 and 4). However, a wide range of pathogenesis was
observed when symptoms were evaluated (Table 5). Initially, the symptoms
appeared as yellow flecks on the 4th day of inoculation, which then
increased in size and became sunken lesion. Subsequently, the lesions
progressed to a grayish tint in the center surrounded by a yellow halo. All five isolates of A.
linariae were virulent to tomato leaves with the
DSI ranged from 51.4 to 68.6% and 11.4 to 51.4% on potato leaves (Table 5). A. linariae
isolate Egy-T2 was found to be the most aggressive isolate on tomato leaves as
it induced more severe symptoms with the highest disease severity index 68.6%, while it did not
exhibit any pathogenicity on potato leaves and the inoculated leaves remained
asymptomatic. Two of the isolates of A. solani
(Egy-T4 and Egy-P1) produced typical early blight symptoms on both tomato and
potato leaves. Egy-P1 was more severe on both tomato and potato leaves than
Egy-T4 whereas DSI of Egy-T4 was 22.9% on tomato leaves and 17.1% on potato
leaves, while DSI of Egy-P1 was 37.1% on tomato leaves and 45.7% on potato
leaves. Generally, two different patterns of symptoms were induced by A. solani and A. linariae
isolates. For instance, A. linariae
induced wide and irregular lesions that covered most of the expanded area of
the inoculated leaves, while A. solani
produced limited lesions around the inoculated areas (Fig. 4). All Alternaria
isolates were re-isolated successfully from all leaf lesions to fulfill
Koch's postulate. Generally, all A. linariae
isolates were more aggressive on tomato than potato leaves as compared to A.
solani isolates.
Table 4:
Morphological
characteristics of A. linariae and A. solani isolates
Isolate Code |
species |
Colony colour* |
Body** |
Beak |
Septa |
||
Length µm |
width µm |
length µm |
Long. |
Tran. |
|||
Egy-T1 |
A. linariae |
Greyish to black with red
pigment |
98.84 |
22.46 |
111.82 |
6-10 |
1-7 |
Egy-T2 |
A. linariae |
Greyish-white, - No
pigmentation |
106.13 |
20.93 |
104.76 |
4-9 |
0-4 |
Egy-T3 |
A. linariae |
dark grey to black with pale
pigment |
33.64 |
17.20 |
64.09 |
3-5 |
1-2 |
Egy-T4 |
A. solani |
dark grey to black with dark
pigment |
77.61 |
16.94 |
116.06 |
5-11 |
3-7 |
Egy-T5 |
A. linariae |
Greyish to black with red
pigment |
113.18 |
21.27 |
117.77 |
4-7 |
0-4 |
Egy-T6 |
A. linariae |
Greyish to black with red
pigment |
136.22 |
28.51 |
135.01 |
6-10 |
2-6 |
Egy-P1 |
A. solani |
Black with pale red pigment |
70.63 |
25.05 |
27.91 |
2-5 |
0-3 |
* colony colour was recorded on fungal culture grown on
V8JA at 25+
2°C for 10 days
** measurement of conidial structure
Table 5: Pathogenicity test of A. solani and A. linariae
isolates on potato and tomato detached leaves under in vitro conditions
Alternaria species |
Isolates Code |
Disease severity index (DSI%) |
|
Tomato leaves |
Potato leaves |
||
A. linariae |
Egy-T1 |
54.3 |
37.1 |
A. linariae |
Egy-T2 |
68.6 |
0.0 |
A. linariae |
Egy-T3 |
45.7 |
11.4 |
A. solani |
Egy-T4 |
22.9 |
17.1 |
A. linariae |
Egy-T5 |
51.4 |
51.4 |
A. linariae |
Egy-T6 |
65.7 |
42.9 |
A. solani |
Egy-P1 |
37.1 |
45.7 |
LSD |
0.685 |
0.52 |
Table 6: Effect of different fungicides on the mycelial growth of
A. linariae and A. solani isolates
Isolate Code |
Fungicides |
|||||||||||||
Inhibition
of mycelial growth (%) |
||||||||||||||
(A)
Aveet |
(D)
Decent plus |
(C)
Cuprofix CM |
(R)
Ridomil gold R |
(P)
Prevex |
(S)
Saver |
Control |
||||||||
G* mm |
I%** |
G mm |
I% |
G mm |
I% |
G mm |
I% |
G mm |
I% |
G mm |
I% |
G mm |
I% |
|
Egy-T1 |
0 |
100 |
0 |
100 |
29 |
67.8 |
38 |
57.8 |
31 |
65.6 |
81 |
10 |
90 |
0 |
Egy-T2 |
5 |
94.4 |
12 |
86.7 |
43 |
52.2 |
18 |
80 |
70 |
22.2 |
68 |
24.4 |
90 |
0 |
Egy-T3 |
0 |
100 |
0 |
100 |
46 |
48.9 |
40 |
55.6 |
78 |
13.3 |
90 |
0 |
90 |
0 |
Egy-T4 |
0 |
100 |
0 |
100 |
53 |
41.1 |
27 |
70 |
79 |
12.2 |
88 |
2.2 |
90 |
0 |
Egy-T5 |
0 |
100 |
19 |
78.9 |
60 |
33.3 |
28 |
68.9 |
50 |
44.4 |
74 |
17.8 |
90 |
0 |
Egy-T6 |
12 |
86.7 |
12 |
86.7 |
50 |
44.4 |
25 |
72.2 |
82 |
8.9 |
90 |
0 |
90 |
0 |
Egy-P1 |
0 |
100 |
17 |
81.1 |
12 |
86.7 |
23 |
74.4 |
90 |
0 |
85 |
5.6 |
90 |
0 |
LSD |
Fungi=
4.853 fungicide =4.292 Fungi X fungicide= 10.51 |
* growth of Alternaria
isolates (mm) on PDA media (mean of four replicates)
**Inhibition of the mycelial growth (%)
Evaluation of the inhibitory effect of selected
fungicides on the isolates
The
inhibitory effect of different commercially available fungicides (Aveet, Decent plus, Cuprofix CM, Ridomil Gold R, Prevex, Saver) on
the hyphal extension and colony growth of seven Alternaria isolates was
investigated (Table 6). All the tested fungicides had significant delaying or
inhibiting effect on the mycelial growth of Alternaria spp. However, Aveet 75% WG (azoxystrobin 5% + mancozeb 70%) had strong
inhibitory effect and was able to reduce the growth of all the isolates ranging
from 86.7 to 100%, followed by Decent plus (difenoconazole 12.5% + azoxystrobin
20%) whose inhibitory effect ranged from 78.9 to 100%, Ridomil Gold R (metalaxyl M 2% +
metalic copper 14.19%) inhibited from 55.6 to 80.0%
and Cuprofix CM (cymoxanil 2.5% + metalic
copper 15%)
Fig. 3: Early blight
symptoms exhibited by all the isolates on potato detached leaves. Both sides of
the leaves, adaxial sides (mentioned in capital letters) and abaxial sides
(mentioned in small letters) are shown. The leaves were either non-inoculated (A, a)
or inoculated with Egy-P1 (B, b), Egy-T1 (C, c), Egy-T2 (D, d),
Egy-T3 (E, e), Egy-T4 (F, f), Egy-T5 (G, g), and Egy-T6 (H, h).
The experiment was conducted using detached of 30-day-old plants of potato (cv.
Spunta). Leaves were photographed at 7 days
post-inoculation and disease severity (DS) was scored on a 0-5-point rating
system
Fig. 4: Early blight
symptoms exhibited by all the isolates on tomato detached leaves. Both sides of
the leaves, adaxial sides (mentioned in capital letters) and abaxial sides
(mentioned in small letters) are shown. The leaves were either non-inoculated (A, a)
or inoculated with Egy-P1 (B, b), Egy-T1 (C, c), Egy-T2 (D, d),
Egy-T3 (E, e), Egy-T4 (F, f), Egy-T5 (G, g), and Egy-T6 (H,
h). The experiment was conducted using detached of 30-day-old plants of tomato
(cv. Super strain B). Leaves were photographed at 7 days post-inoculation and
disease severity (DS) was scored on a 0-5-point rating system
from 33.3 to 67.8%, respectively. Nonetheless, Prevex (Propamocarb hydrochloride) and Saver (cymoxanil 5%
+ chlorothalonil 37%) had the least effect on the mycelial growth of Alternaria
isolates. All the tested isolates exhibited a small degree of variations in
mycelial growth towards the tested fungicides.
Discussion
Alternaria spp. are not only a major limiting factor to tomatoes
and potatoes production, but also causes postharvest spoilage to tomatoes and
potatoes (El-Mougy and Abdel-Kader 2009; Adss et al. 2017). Several Alternaria
spp. have been found infecting potatoes and tomatoes in Egypt, including A.
arborescens, A. alternata,
A. phragmospora and A. solani (Abada et
al. 2008; El-Abd-Kareem et al. 2009; Ashour et al. 2012; El
Gobashy et al. 2018; Hussein and Voigt 2019; Attia et al. 2020).
Among these, A. solani is the most
prevalent and leading cause of EB and A. alternata
is the most prevalent species associated with leaf blight, whereas A.
arborescens has been found to be the least
prevalent in Egypt (El Gobashy et al.
2018; Hussein and Voigt 2019). A very recent study reported the first
identification of A. phragmospora
causing early blight disease in tomato plants (Abdel-Motaal
et al. 2020a, b). The results of the study demonstrated that the
population structure of large-spored Alternaria spp. associated with
early blight disease in Egypt has a more complex structure than previously
observed. The first identification of A. linariae
from tomatoes and the identification of A. solani
from tomatoes and potatoes suggest that the mounting scenario could be
alarming. However, this is far from a conclusion, as this study was based on a
few isolates, but the identification of A. linariae
from most of the collected tomato samples from different areas demonstrated a
changing paradigm. Both of these Alternaria spp. have previously been
found associated with early blight disease of tomatoes and potatoes in Russia
and Algeria (Gannibal et al. 2014; Ayad et
al. 2019).
As the
morphological characterization of Alternaria spp. is a challenging and often
misleading task due to the striking similarities among the conidia of several
species and the cultural features of some Alternaria spp., such
as A. solani, are unstable (Rotem 1994). Similarly, at the molecular
level, the use of a single gene region is insufficient to distinguish various Alternaria
spp. or even the same group of individual isolates (Woudenberg et al. 2013, 2015; El Gobashy et al. 2018).
To circumvent this problem, a multi-locus phylogeny was followed which
demonstrated that the use of multiple genes, such as GAPDH, ITS, RPB2,
OPA10-2, Alt a 1, endoPG
and KOG1058, could separate all the isolates and species belonging to Alternaria
(Woudenberg et al. 2014). Therefore, the
same strategy was followed in this study and five genes (ITS, TEF, GAPDH, ALT
and RPB2) were included which revealed a higher genotype level in Alternaria
spp. and easily distinguish our isolates.
A comparative study with representative strains
helped to ascertain that the two Alternaria spp., A. linariae and A. solani,
are found associated with tomato and potato plants. A varying degree of
coloration was exhibited by our isola A. linariae and A. solani
on different media. Morphological characters of A. solani
or A. linariae on V8JA media were quite
close to those defined by Simmons (2007) and V8JA was the only media that
induced sporulation of all the isolates. To achieve closely related
morphological identification, the beak length and its branching and conidial
body size were studied. Sporulation was conducted on V8JA plates to distinguish
the two species, but it is important to take into account that the conidia size
and shape depend on the used substratum. Compared to V8JA, both species
produced two types of beaks, long and short. Similar findings have been
appraised for other large-spored Alternaria species, for example, A. calendulae (Simmons 2007).
Cultural characters have been used previously to identify different Alternaria
spp. especially A. solani populations (Ivanuk and Palilova 1996), additionally, it is
noteworthy that the cultural characters of A. solani
are unstable (Rotem 1994).
Pathogenicity assay and cross-inoculation of
detached tomato and potato leaves revealed that A. linariae
infected all the inoculated tomato and potato leaves except Egy-T2 isolate
which was avirulent on the potato. Variation of severity between all the tested
isolates was observed indicating that there are different types of
aggressiveness in the Egyptian population of Alternaria spp. However,
there was a strong infection and association with tomato plants as the induced
symptoms were more severe. A. linariae
was able to infect the leaves of the potato, but with less aggressiveness than
the tomatoes. This may indicate that A. linariae
isolates are acclimatizing rapidly under Egyptian environmental conditions.
While A. solani also infected both
tomatoes and potato leaves with a moderate degree of aggressiveness. These
results are consistent with earlier reports in which A. linariae showed strong association and
aggressiveness with tomato leaves but weak with potato leaves (Rodrigues et al. 2010; Gannibal et al.
2014). However, A. solani was
moderately aggressive to tomato and potato leaves (Ivanuk and Palilova 1996; Gannibal et al. 2014). In
contrast to our observation, A. solani
and A. linariae have been found
infecting their respective potato or tomato hosts in Algeria, but
cross-inoculations on detached leaflets had shown that the aggressiveness
towards the two host leaves varies depending on the isolate but not on the
specific fungal species (Ayad et al. 2019). Thus, our results
are congruent to earlier studies that both two Alternaria spp. can
infect both tomatoes and potato plants but exhibit severe symptoms in their
respective hosts.
Early blight disease is prevalent wherever potatoes and
tomatoes are cultivated. The disease is considered difficult to control since
only a few cultivars having a strong resistance are available (Xue et al. 2019). The most effective
control measure is the frequent use of fungicides at the early stage of the
growing season (Horsfield et al. 2010; Odilbekov
et al. 2019). An effective control strategy is a key prerequisite
for achieving a laconic control over early blight disease. This research was
further extended to evaluate the inhibitory effects of six commercial
fungicides on the growth of A. linariae
and A. solani isolates under in
vitro conditions. Although all of the tested fungicides significantly inhibited
mycelial growth, but the systemic fungicide, Aveet
75% WG (azoxystrobin 5% + mancozeb 70%), substantially inhibited the colony
growth up to 100% in five of the seven tested isolates of A. solani and A. linariae.
The next most effective fungicide was Decent plus 32% SC (Difenoconazole 12.5%
+ Azoxystrobin 20) which inhibited colony growth ranging from 78.9 to 100%.
Difenoconazole, along with boscalid and pyraclostrobin, was reported to exhibit better performance
against A. solani in 2014 but not in
2017, later the underlying reason for poor performance was found to link with
mutations and the lower infection pressure in 2017 (Odilbekov et al. 2019). The protective mancozeb and the systemic
azoxystrobin and difenoconazole materials are widely used fungicides against A.
solani in Solanaceous crops (Rosenzweig et al. 2008; Horsfield et al.
2010). The current finding confirms the reports of several earlier
studies that reported the efficacy of Mancozeb on inhibiting the growth of A.
solani isolated from tomato (Gondal et al. 2012; Singh et al. 2018).
Wang et al. (2008) showed that
sixty isolates of A. solani were
sensitive to difenoconazole using the mycelial growth method. Horsfield et al. (2010) also reported
that azoxystrobin and difenoconazole were highly effective in controlling EB
under field conditions.
The symptoms induced by A. solani
and A. linariae isolates on the
detached leaves of potatoes and tomatoes did not differ significantly from that
of the infected tomato and potato plants collected from the field. Similar
results have been obtained for A. tenuissima,
A. alternata and A. solani (Zheng et
al. 2015). However, a few studies found contrasting results, where
the symptoms induced by A. alternata
and A. solani differ substantially from
those of the early blight disease symptoms observed in field plants. The
observed difference may be due to the detached leaf (DL) assay, as no
correlation has been observed between the pathogenicity of the DLassay in greenhouse conditions and/or field conditions (Foolad et al. 2000; El Gobashy et al. 2018).
However, both greenhouse and field tests have a clear correlation, suggesting
that whole-plant inoculation is the best method for assessing the pathogenicity
of Alternaria spp. associated with early blight disease. The reason
behind this difference is unclear yet and requires further investigations.
Summarizing all our results, such as the aggressiveness and adaptability of A. linariae to tomato and potato plants along with
aberrant climatic changes, we can suggest
that A. linariae, either alone or with A.
solani, could potentially cause substantial
losses to tomato and potato production in Egypt. However, a comprehensive
disease-survey, assessment of the susceptibility of the available tomato and
potato cultivars, synergistic interactions between A. linariae and A. solani,
evaluation of pathogenicity under greenhouse conditions and characterization of
A. linariae is a prerequisite to assess
the mounting scenario.
Conclusion
The underlying pathogens associated with early blight
disease in Egypt are found to be more diverse than previously recognized. A
higher level of pathogenicity of A. linariae
on potato and tomato plants revealed its potential to become a wide-spread and
leading cause of early blight disease, either alone or combining with other Alternaria
spp. Further studies are necessary to reveal the aggressiveness, distribution,
symptoms pattern in the field and difference in fitness of the species.
Acknowledgments
The
authors extend their appreciation to the Deputyship for Research & Innovation,
Ministry of Education in Saudi Arabia for funding this research work through
project number IFT 20023.
Author
Contributions
SME and SEE isolated the pathogen and evaluated the
fungicides. YA wrote the discussion section. ZI and SME performed molecular
analysis. SME, SEE and YA drafted the first version of the manuscript. ZI draw
figures and drafted the final manuscript which was approved by all the authors.
Conflicts
of Interest
The authors declare that they have no conflict of interest.
Data Availability
The data will be made avaialble on acceptable requests to the
corresponding author.
Ethics
Approval
Not applicable.
References
Abada
KA, S Mostafa, MR Hillal (2008). Effect of some
chemical salts on suppressing the infection by early blight disease of tomato. Egypt J Appl Sci
23:47‒58
Abdel-Motaal F, N Kamel, S El-Zayat, M Abou-Ellail (2020a).
Early blight suppression and plant growth promotion potential of the endophyte Aspergillus
flavus in tomato plant. Ann Agric Sci 65:117‒123
Abdel-Motaal F, N Kamel, S El-Zayat, M Abou-Ellail (2020b).
First report of Alternaria phragmospora causing early
blight disease of Lycopersicon esculentum in Egypt. J Biol Sci 3:1‒8
Adhikari P, Y Oh, DR Panthee
(2017). Current status of early blight resistance in tomato: An update. Intl
J Mol Sci 18; Article 2019
Adss
I, H Hamza, E Hafez, H Heikal (2017). Enhancing
tomato fruits post-harvest resistance by salicylic acid and hydrogen peroxide
elicitors against rot caused by Alternaria solani.
J Agric Chem Biotechnol 8:1‒8
Alves A, P Crous, A Correia, A
Phillips (2008). Morphological and molecular data reveal cryptic species in Lasiodiplodia theobromae.
Fung Divers 28:1‒13
Ashour A, TA Rahman, H Badawy,
N Dib (2012). Chemical control of tomato early blight disease. Egypt J Phytopathol 40:149‒162
Attia MS, GS El-Sayyad, MA Elkodous,
AI El-Batal (2020). The effective antagonistic
potential of plant growth-promoting rhizobacteria against Alternaria solani-causing early blight disease in tomato plant. Sci
Hortic 266; Article 109289
Ayad D, D Aribi, B Hamon, A Kedad, P Simoneau, Z Bouznad (2019). Distribution of large-spored Alternaria
species associated with potato and tomato early blight according to hosts and
bioclimatic regions of Algeria. Phytopathol
Mediterr 58:139‒149
Berbee
ML, M Pirseyedi, S Hubbard (1999). Cochliobolus
phylogenetics and the origin of known, highly virulent pathogens, inferred from
ITS and glyceraldehyde-3-phosphate dehydrogenase gene sequences. Mycologia 91:964‒977
Birch PRJ, G Bryan, B Fenton, EM Gilroy, I Hein, JT
Jones, A Prashar, MA Taylor, L Torrance, IK Toth (2012). Crops that feed the world 8: Potato:
are the trends of increased global production sustainable? Food Secur 4:477‒508
Chaerani
R, RE Voorrips (2006). Tomato early blight (Alternaria
solani): the pathogen, genetics, and breeding
for resistance. J Gen Plant Pathol 72:335‒347
Dellaporta
S, J Wood, J Hicks (1983). A rapid method for DNA extraction from plant tissue.
Plant Mol Biol Rep 1:19‒21
Edgar RC (2004). MUSCLE: multiple sequence alignment
with high accuracy and high throughput. Nucl
Acids Res 32:1792‒1797
El-Abd-Kareem F, FM Abd-El-Faten,
YO Fotouh (2009). Integrated treatments between humic acid and sulfur for
controlling early blight disease of potato plants under field infection. Res
J Agric Biol Sci 5:1039‒1045
El-Mougy N, M Abdel-Kader
(2009). Salts application for suppressing potato early blight disease. J Plant Prot Res
49:353‒361
El Gobashy SF, WZA Mikhail, AM
Ismail, A Zekry, A Moretti, A Susca,
AS Soliman (2018). Phylogenetic, toxigenic and virulence profiles of Alternaria
species causing leaf blight of tomato in Egypt. Mycol
Progr 17:1269‒1282
FAOSTAT (2018). Food and Agriculture Organization of the
United Nations Statistics Division. Available: http://faostat3.fao.org/home/E (Accessed:
September 14, 2020)
Foolad
M, N Ntahimpera, B Christ, G Lin (2000). Comparison
of field, greenhouse, and detached-leaflet evaluations of tomato germplasm for
early blight resistance. Plant Dis 84:967‒972
Gannibal
PB, AS Orina, NV Mironenko,
MM Levitin (2014). Differentiation of the closely related species, Alternaria solani
and A. tomatophila,
by molecular and morphological features and aggressiveness. Eur J Plant Pathol 139:609‒623
Gondal
AS, M Ijaz, K Riaz, AR Khan (2012). Effect of different doses of fungicide
(mancozeb) against alternaria leaf blight of tomato
in tunnel. J Plant Pathol Microbiol
3; Article 1000125
Grigolli
JFJ, MM Kubota, DP Alves, GB Rodrigues, CR Cardoso, DJH deSilva,
ESG Mizubuti (2011). Characterization of tomato
accessions for resistance to early blight. Crop Breed Appl
Biotechnol 11:174‒180
Hong SG, RA Cramer, CB Lawrence, BM Pryor (2005). Alt a 1
allergen homologs from Alternaria and related taxa: analysis of
phylogenetic content and secondary structure. Fung Genet Biol
42:119‒129
Horsfield A, D Wilson, S Paton, T Wicks, K Davies (2010).
Effect of fungicide use strategies on the control of early blight (Alternaria
solani) and potato yield. Aust
Plant Pathol 39:368‒375
Hussein MA, K Voigt (2019). Phylogenetic and enzymatic
variability of Alternaria species isolated from various substrates in
Qena governorate of Upper Egypt. Arch Phytopathol
Plant Prot 52:530‒541
Ivanuk
V, A Palilova (1996). Structure of Alternaria solani (Ell. et Mart.) Jones et Gront
population- the pathogen of potatoes alternariosis
and its dynamic in Byelorussa. Mikol
Fitopatol 30:66‒74
Javaid
A, GR Shahzad, N Akhtar, D Ahmed (2018). Alternaria leaf spot disease of
broccoli in Pakistan and management of the pathogen by leaf extract of Syzygium cumini. Pak J Bot 50:1607‒1614
Javaid
A, N Akhtar, A Khan, A Shoaib
(2016). New host record of Alternaria brassicicola infecting triangle palm (Dypsis decaryi) in Pakistan. J Anim Plant Sci
26:1894‒1898
Khan M, R Wang, B Li, P Liu, Q Weng, Q Chen (2018).
Comparative Evaluation of the LAMP assay and PCR-based assays for the rapid detection
of Alternaria solani. Front Microbiol 9; Article 2089
Kumar S, G Stecher, M Li, C Knyaz, K Tamura (2018). MEGA X: Molecular evolutionary
genetics analysis across computing platforms. Mol Biol
Evol 35:1547‒1549
Langsdorf
G, N Furuichi, N Doke, S Nishimura (1990).
Investigations on Alternaria solani Infections:
Detection of alternaric acid and a
susceptibility-inducing factor in the spore-germination fluid of A. solani. J
Phytopathol 128:271‒282
Lawrence DP, PB Gannibal, TL Peever, BM Pryor (2013). The sections of Alternaria:
formalizing species-group concepts. Mycologia
105:530‒546
Leiminger
JH, B Adolf, H Hausladen (2014). Occurrence of the
F129L mutation in Alternaria solani
populations in Germany in response to QoI
application, and its effect on sensitivity. Plant Pathol
63:640‒650
Liu YJ, S Whelen, BD Hall
(1999). Phylogenetic relationships among ascomycetes: evidence from an RNA polymerse II subunit. Mol Biol
Evol 16:1799‒1808
Nene YL, PN Thapliyal (1993). Fungicides in Plant
Disease Control, 3 Edition. International Science Publisher, New York, USA
Nicola S, G Tibaldi, E Fontana
(2009). Tomato production systems and their application to the tropics. In:
International Symposium on Tomato in the Tropics, Villa de Leyva, Colombia,
2009, pp: 27‒34. International Society for Horticultural Science
(ISHS), Leuven, Belgium
Odilbekov
F, E Edin, H Mostafanezhad, H Coolman,
LJ Grenville-Briggs, E Liljeroth (2019).
Within-season changes in Alternaria solani
populations in potato in response to fungicide application strategies. Eur J
Plant Pathol 155:953‒965
Rodrigues T, M Berbee, E
Simmons, CRC Carine, A Reis, L Maffia, E Mizubuti (2010). First report of Alternaria tomatophila and A. grandis causing early blight
on tomato and potato in Brazil. New Dis Rep 22:28–28
Rosenzweig N, G Olaya, ZK Atallah, S Cleere, C Stanger, WR
Stevenson (2008). Monitoring and tracking changes in sensitivity to
azoxystrobin fungicide in Alternaria solani in
wisconsin. Plant Dis 92:555‒560
Rotem J
(1994). The genus Alternaria biology, epidemiology, and pathogenicity. APS
Press, St. Paul, Minnesota, USA
Rotem
J, I Reichert (1964). Dew-a principal moisture factor enabling early blight
epidemics in a semiarid region of Israel. Plant Dis Rep 48:211‒215
Sharma P, SR Sharma, M Sindhu, A Kaur (2004). A detached
leaf technique for evaluation of resistance in cabbage and cauliflower against
three major pathogens. Ind J Plant Pathol
22:112‒114
Siam G, T Abdelhakim (2018).
Analysis of the tomato value chain in Egypt and establishment of an action plan
to increase its efficiency. Doctoral Dissertation,
p: 118. CIHEAM-IAMM, Montpellier, France
Simmons EG (2007). Alternaria: an identification manual. CBS Fungal Biodiversity Centre, Utrecht,
The Netherlands
Simmons EG (2000). Alternaria themes and
variations (244–286) species on Solanaceae.
Mycotaxon 75:1‒115
Singh VP, RU Khan, D Pathak (2018). In vitro
evaluation of fungicides, bio-control agents and plant extracts against early
blight of tomato caused by Alternaria solani (Ellis
and Martin) Jones and Grout. Intl J Plant Prot 11:102‒108
Tamura K, M Nei (1993).
Estimation of the number of nucleotide substitutions in the control region of
mitochondrial DNA in humans and chimpanzees. Mol Biol
Evol 10:512‒526
Vakalounakis
DJ (1983). Evaluation of tomato cultivars for resistance to Alternaria
blight. Ann Appl Biol
102:138‒139
Vincent JM (1947). Distortion of fungal hyphæ in the presence of certain inhibitors. Nature
159:850–850
Wang Hq, JS Tian, QP Yan (2008).
Comparison of the sensitivity of Alternaria solani
which causing tomato late blight to seven fungicides and its
baseline-sensitivity to difenoconazole. Pesticides -Shenyang 47:294‒296
Weber B, DA Halterman (2012).
Analysis of genetic and pathogenic variation of Alternaria solani from a potato production region. Eur J Plant Pathol 134:847‒858
White TJ, T Bruns, S Lee, J Taylor (1990). Amplification
and direct sequencing of fungal ribosomal RNA genes for phylogenetics. PCR Protoc Guide Meth Appl 18:315‒322
Woudenberg
JHC, MF Seidl, JZ Groenewald, MD Vries, JB Stielow, BPHJ Thomma, PW Crous (2015). Alternaria section Alternaria:
species, formae speciales
or pathotypes? Stud Mycol 82:1‒21
Woudenberg JHC,
M Truter, J Groenewald, P Crous (2014). Large-spored Alternaria
pathogens in section Porri disentangled. Stud Mycol 79:1‒47
Woudenberg
JHC, JZ Groenewald, M Binder, PW Crous (2013). Alternaria
redefined. Stud Mycol 75:171‒212
Xue
W, KG Haynes, X Qu (2019). Characterization of early blight resistance in
potato cultivars. Plant Dis 103:629‒637
Zheng HH, J Zhao, TY Wang, XH Wu (2015).
Characterization of Alternaria species associated with potato foliar
diseases in China. Plant Pathol 64:425‒433